Dinkum Journal of Natural & Scientific Innovations (DJNSI)

Publication History

Submitted: October 08, 2023
Accepted:   October 11, 2023
Published: December 11, 2023

Identification

D-0171

Citation

Saffora Riaz, Kinza Imtiaz, Lubna Rasheed, Aqsa Mubeen, Tasneem Kausar & Rooha Farooq (2023). Identification of the Bacterial Pathogen of Ticks and Ticks Infestation in Buffaloes in District Gujranwala. Dinkum Journal of Natural & Scientific Innovations, 2(12):794-814.

Copyright

© 2023 DJNSI. All rights reserved

Identification of the Bacterial Pathogen of Ticks and Ticks Infestation in Buffaloes in District GujranwalaOriginal Article

Saffora Riaz 1*, Kinza Imtiaz 2*, Lubna Rasheed 3, Aqsa Mubeen 4, Tasneem Kausar 5, Rooha Farooq 6

  1. Assistant professor, Department of Zoology, Lahore College for Women University, Lahore, Pakistan.
  2. Lahore College for Women University, Lahore, Pakistan.
  3. University of agriculture, Faisalabad, Pakistan.
  4. Lahore College for Women University, Lahore, Pakistan
  5. Government College for Women University, Sialkot, Pakistan
  6. Government College for Women University, Sialkot, Pakistan

* Correspondence: Riazsaffora@gmail.com & kinzaimtiaz156@gmail.com

Abstract: Ticks and other ectoparasites carry a variety of pathogens that can cause a variety of dangerous diseases. In tropical and subtropical climate like Pakistan, ticks are most common ectoparasite of domestic animal cause major cost effective. The purpose is to examine the epidemiological infestation of ticks in buffalo from various portions of the district in Gujranwala, Pakistan, as well as species identification. To draw attention to the existence of aerobic bacteria in buffaloes afflicted with live ticks. A total of 250 buffaloes were chosen at random, and evaluated for tick infestation on organised and disorganised dairy farms. From January through May of 2021, an epidemiological survey was undertaken. Tick infestations in buffalos were at their greatest in June. The prevalence of tick higher (p<0.05) in the tail, and udder in all three sites were noted. Ticks of three different species were also discovered (Hyalomma anatolicum, Rhipicephalus annulatus, and Boophilus microplus). Six bacterial species were identified from the   midgut of   tick were Enterobacter spp. (33.48%), E.coli (48.02%), Enterococcus (38.05%), Bacillus spp. (21.11%), Salmonella (26.42%) and   staphylococci (18.98%). The identification of bacteria from the salivary gland   of tick   was Enterobacter spp. (19.85%), E.coli (49.07%), Enterococcus (48.52%), Bacillus spp. (37.64%), Salmonella (44.26%) and   staphylococci (13.88%). A 1kb ladder was used to identify a 2000bp tick DNA fragment. The data were analysed using Statistical Analysis, which was utilize to compare the results at a significant threshold of P < 0.05. This study contributed to the development of successful tick control policies in the study district by providing more information on epidemiological tick infestation.

Keywords: E.coli, Enterobacter, Enterococcus, Salmonella, Staphylococcus, Bacillus, Hyalomma anatolicum, Rhipicephalous, Boophilus microplus

  1. INTRODUCTION

Ticks and other ectoparasites carry a variety of pathogens that can cause a variety of dangerous diseases. In tropical and subtropical climate like Pakistan, ticks are most common ectoparasite of domestic animal cause major cost effective (Durrani and Shakoori, 2009). Ticks are bloodsuckers to harm cattle’s skin and hide, affect them to proliferative dermatitis and infestation, produce paralysis or toxicosis, and inflict physical harm. They also carry viruses, bacteria, spirochetes, rickettsiae, and protozoans, among other dangerous microbes (Jongejan and Uilenberg, 2004). Pakistan has a tick infestation rate of more than 50% (Sajid et al., 2009). In Pakistan’s dairy business, the most typical combined impacts of tick and tickborne diseases are a reduce milk production as well as reduce the quality of hide and fur. According to studies on ruminants, sheep, goats, dairy cattle, and buffalo, tick infection is mainly common and economically important in household animals (Mustafa et al., 2014; Hassan and Zubaidi, 2014). Ticks are more active in the summer and spring, compared to other seasons. Into state, few study on occurrence of tick infection in household living thing, mostly ruminant limited to a acclimatize zones (Irshad et al., 2014; Sultana et al., 2015). Dairy buffalo milk production is influenced by a variety of ecological   factor like diet, feed schedule, shelter, atmosphere, and parasite load and illness position. Parasitic infection is regarded to be a key stumbling block in the development of animal populations, especially buffaloes. Ticks can infect a variety of hosts and transmit diseases to human, domestic animals, and other animals base on atmosphere, water accessability, ground utilize, and physiographic part of Pakistan (Durrani and Shakoori, 2009). Coxiella burnetii, a zoonotic infection of vertebrates found all over the world causes Q fever. In the majority of cases, the clinical symptoms are self-limiting febrile illnesses, with reproductive disorders in some species. Coxiella burnetii strains are descended from a wide range of Coxiella-like endosymbionts (Heutschis et al., 2017).

The tick life cycle starts with the intake of food, which is followed by the bacteria move from the gut to the hemocoel, the route differs depend upon the micro-organism. Before traveling to the salivary glands, show that blood meals start this migration from the midgut. For example, Borrelia and Bartonella species food stored in the abdomen. Anaplasma, and Ehrlichiaspecies, on the other hand, can reproduce in the midgut of unfed ticks and move to the salivary glands (Reagan et al., 2007). Tick control can be done in a variety of ways, but each method has its own set of drawbacks. Chemical management with acaricides was once thought to be one of the most effective treatments, however, according to new research ticks acquired resistance to many insecticides, these substances, on the other hand, are both dangerous and costly. The current situation is unsatisfactory due to chemical residues in food and the environment for all production systems, which is why there a discussion about developing an alternative control method, for example, a vaccine (George et al., 2004). In cattle antimicrobial medicines are currently unavailable for treating chronic infection. Despite the World Organization for Animal Health’s advice that enrofloxacin, imidocarb and oxytetracycline be used to treat persistent A. marginale infections in cattle, they have not been demonstrated to be efficacious (Coetzee et al., 2005). In the treatment of anaplasmosis, vaccines have been used instead of antibiotics. A live vaccination is available in South Africa, Australia, Israel, and Latin America. However, a vaccine has only been shown modestly helpful, and there have been numerous incidents of vaccination failure (Kocan et al., 2003). The objectives of the study were to conclude the epidemiological infestation of ticks in buffalo, from various sections, and recognized the species that infected buffalo, to draw attention to the existence of aerobic bacteria in live tick-infested buffalo in the Gujranwala district, to observed different parts of buffaloes to detect the tick’s infestation, to determine the morphological identification of the collected ticks, and to observe the molecular analysis of ticks by using PCR technique.

  1. LITERATURE REVIEW

Lyme disease, babesiosis, and tick-borne encephalitis were previously determined Ixodes persulcatus ticks were collected in various regions (Moriarity et al. 2007; Gasner et al. 2007). Rhipicephalus (Boophilus) microplus, investigated a cattle-like tick, is a significant threat to increasing milk production in tropical and subtropical climates worldwide (Jonsson et al. 2009). Ticks investigated to transmit the course of viral, protozoal, and viral infections are able to cause actual contamination in human and nearby nature, such as exposure (Halverson et al. 2010; Crowder et al. 2010). To study in Punjab (District Sargodha), Pakistan, to investigate the rate of tick infection in birds and goats. Between October 2012 and September 2013, an average of 1200 bulls and goats were tested to strengthen the tick-borne infection rate (Shabbir et al. 2014). Tiny harmful bacteria found to trap in solid tracks that stick to animals and the ground in Turkey and Iraq. According to the keys they had arranged, 195 heavy ticks were found. There were 195 ticks in total and 149 Hyalomma spp. in addition, 46 Rhipicephalus spp (Kirecci et al. 2015; Jalil and Zenad 2015). A stud investigated the direct confirmation and attack of Ixodidae and Argaside disease in Gadel from various parts of the Khairpur region of Pakistan (Abbasi et al. 2017; Grantham et al. 2017)). Tick-borne infections (TBP) cause significant financial difficulties in raising dairy cows worldwide (Kolte et al. 2017). Tick infestations increase in various parts of cattle and different parts of the country in the year 2017/2018 (Dhital et al. 2018). Tick’s role in transmitting small entities of Enterobacteriaceae was to wild cattle in the wetlands of southern Iraq. Between May 2017 and April 2018, 255 buffaloes and unhealthy birds were tested in the lakes of southern Iraq (Ti-Qar, Basra, and Misan) (Khalaf et al. 2018). Midgut and salivary glands are critical organs of tick infection and transmission. Still, the salivary glands and their appearance are essential in transmitting the microorganism to the host (Lejal et al. 2019).

  1. METHODOLOGY

3.1 Location and climate of study area

The research carried out in the Punjab Province’s district of Gujranwala (Pakistan). The district of Gujranwala is located in Punjab’s North-East province. It stretches from latitude 27.53°N to longitude 68.77°E. The geographical area 15, 910 km located between 50 and 100 meters above sea level. The district of Gujranwala contains eight subdivisions (Tehsil), and this research focuses on the three most populous. This cross-sectional epidemiological study was done from April to September 2020, throughout the summer season. In the summer, the study area’s climate extremely hot and dry, with temperatures ranging from 27°C to 47°C with an expected yearly rain of 12 mm.

Figure 01: Map of Gujranwala showing location of study district (Source: https://eproperty.pk/maps/gujranwala).

Figure 1:  Map of Gujranwala showing location of study district   (Source: https://eproperty.pk/maps/gujranwala).

3.2 Questionnaire survey

The epidemiological survey was conducted from different parts of buffaloes. The   study carried out in   conformity with the institution fair team recommendations (Faculty of Lahore College for Women University, Lahore Pakistan). All techniques and experiments involving animal experimentation and animal care were obedient with the instructions and allowed by the institution committee, and all typical protocol were followed.

3.3 Specimen collections

Ticks sample (n=250) were collected and 200 buffaloes were tested for tick infestation. At each farm, roughly (n=20) buffaloes from both ordered and unstructured farms randomly selected for sample collection. The collection completed in the morning and evening. Tick was found by running a pass over the animal skin; the different stage of tick was gathered using forceps and brushes without damaging the ticks’ mouthparts. Ticks were gathered from several sections of buffaloes bodies, including the head, ear, abdomen, udder and tail. Because of the high density of tick adhesion, these regions were chosen.

3.4 Preservation of ticks     

The ticks were collected and preserved in a artificial container contain 70% ethanol and 30% glycerin before being sent to the laboratory for further research. Location of collection, body site of collection as well as the species was all documented.

3.5 Identification of tick species

A morphological investigation of tick specie identification   carried out in the Department of Zoology’s laboratory using a high-powered microscope. Identification was done up to the species level using the keys and checklists previously described. The number of infested animal during the time/the number of examined animal during at particular× 100 (Walker et al., 2003) were calculated. Under the stereo microscope, 120 ticks were recognised using the key and taxonomy criterion (like mouthparts, legs colour, festoon, scutum, anal shelter)  (Dumler and Rosen-Feld, 2000; Walker et al., 2003).

3.6 Microbiological analysis

All ticks cleaned in brine solution (0.9 percent NaCl)   then steriled with 70 percent ethanol before being washed in brine solution once more. All ticks were placed in double distill water (ddH2O) tubes. Tubes homogenised at 3000 rpm for 3 minutes with a homogenizer (Daihan HS-30E, DAIHAN Scientific, Korea) and centrifuged on 4000 rpm for 30 min to extract supernatants (Stojek and Dutkiewicz, 2004). All supernatant inoculated on  5 percent sheep blood agar and Merck’s (endo agar). The cultures were then cultured at 37°C for 24-48 hours in aerobic and anaerobic medium. The colonies were tested using standard microbiological techniques  (Dumler and Rosen-Feld, 2000; Koneman et al., 2006).

3.7 Statistical Analysis

The prevalence of tick infestation data was examined with statistical tools, and the results were reported as mean, ANOVA, and standard deviation. The p<0.05 level was used to determine whether there was a significant difference between the groups.

  1. ANALYSIS AND RESULTS

4.1 Identification of bacteria from external surfaces of ticks

4.1.1 Preparation of media

Microbes were grown on media, which is a type of substrate. To identify distinct bacterial isolates, different types of media were created, including selective media, enrichment media, and differential media.

4.1.2 Sheep blood agar

5gm of dehydrated sheep blood medium (CM #0854, Lab M Limited) was suspended in a 125ml distilled water solution. This material was heated until it was totally dissolved. This material was autoclaved for sterilisation for around 15 minutes at 121̊C after boiling. After autoclaving, this was cooled to 45-50 ̊C and 5 percent sterile sheep blood was added aseptically. Then, for streaking purposes, this mixture was placed into sterile petri plate, then incubate at 37°C to 24 hours.

4.1.3 Endo (Merck) agar

In a 125ml solution of distilled water, 4.5gm of dehydrated endo medium (Lab M Limited,CM #0479) was suspended. 0.5 mL basic fuchsin alcoholic solution (10% w/v) (95 percent Ethyl alcohol). This material was heated until it was totally dissolved. This material was autoclaved for sterilisation for around 15 minutes at 121°C after boiling. This was autoclaved and then cooled to 45-50 ̊C. Then, for streaking purposes, this mixture was placed into sterile petri plate, then incubate at 37°C to 24 hours.

4.1.4 Pouring and streaking analysis        

Place a thermometer in the mixture and keep an eye on it until it reaches about 47 degrees (45- 50 degrees). Allow for cooling and setting of the agar plate (the medium will set like gelatin at room temperature). Once it has set, it is ready to be stored. Sheep blood agar and endo agar were used to inoculate the sample. A colony was selected from the pure cultured plate using a sterilised wire loop and streaked on sheep blood and endo agar plates first. On the burner, the loop was made red hot to sanitise it for the following plate’s streak. The streaked plates were kept in the incubator overnight at 37°C. Growth on a sheep blood agar and endo agar plate was seen after a 24-hour incubation period.

4.2 Identification of bacteria

4.2.1 Gram staining 

Gram staining   used to distinguish the gram positive and gram negative bacteria. On a sterile slide, a drop of distilled water was first inserted. A sterile inoculation loop was used to introduce the bacterial colony into the drop. After air drying the suspended culture, the slide was fixed for three seconds over a Bunsen burner. The culture was first stained for one minute with crystal violet and then rinsed with water. Iodine was employed as a mordant for one minute, after which the slide was decolorized with a mixture of acetone (30%) and alcohol (70%) and washed with water to stop the decolorization. The counter stain was safranin, which was applied for one minute and then rinsed thoroughly with water. Before the cultures were inspected under a microscope, the slides were allowed to dry. Gram-negative bacteria were reddish-pink in colour, while Gram-positive bacteria were purple (Sutton, 2006; Wiley et al., 2008).differentiate

4.3 Molecular Characterization

4.3.1 DNA Extraction and purification

Genomic DNA was extracted from individual tick and stored at −80˚C. Extractions were carried out by manual method. With the manual method the DNA was extracted from tick stored at -20 ̊C. A tick was placed in micro centrifuge tube and kept on ice. Four hundred microliters of TEN extraction buffer (10 mM Tris-HCl   (Cat# T3253), 2 mM EDTA, 0.4 M NaCl (Cat#3S270706), pH 8.0) was added, the tick was homogenized by use sterile plastic pestle. Ten microliters of 10% SDS (Cat# No.28312) and 8 µl of 20 mg ml Proteinase K (Cat# PKR 403) were added to each tube. The solution was mixed well and incubated at 55C for 1 h. Then, 300µl of 6 M NaCl was added to each tube. After centrifugation (20 min; 14,000 rpm), 500µl of supernatant was transferred to a tube, and DNA was precipitated by adding 500µl of 2-propanol (Cat# S010306, Lot#SZBCO230V) (20°C for 20 min). After centrifugation (20 min; 14,000 rpm), the pellet was washed by ice cold 70% ethanol (Lot#SHBL6735, Cat#S240697) and then dried. The pellet was suspended in 50µl of H2O. One microliter was used for the PCR assay.

4.4 Gel Electrophoresis       

4.4.1 Preparation of 50x TAE (Tris acetate EDTA) buffer

A 50X stock solution was prepared by dissolving 242 g Tris base (Cat#T838) in water, adding 57.1 ml glacial acetic (Cat#A35500) and 100 ml of 500 mM EDTA (pH 8.0) solution, and bringing the final volume up to 1 litre.

4.4.2 Preparing of 1x TAE stock solution

To Prepared 1× TAE from 50 X TAE stock solution, dilute 20ml of stock into 980 ml of distill   water. The solution mixed carefully and store in fixed bottle to avoid contamination.

4.5 Gel Preparation

DNA extracted was checked by gel electrophoresis. For this instance 0.8g agarose powder was used to prepare the 0.8% gel. 0.8% gel was formulated by taking 100ml of 1× TAE (Boston BioProduct) and adding 0.8g agarose powder after measuring on the weighing balance. Heated in oven until the clear solution was formed that indicated the complete mixing of agarose powder in the buffer solution. Ethidium bromide about 4 to 5 μl was added in the solution and mixed it slightly. For solidification of gel, the gel casting tray was used. Gel was poured in the casting tray, comb located in the tray and allow to cool and solidified. 1X TAE buffer was added in gel electrophoresis tank until it was wholly filled. Removed the tape from sides and placed the gel casting tray into the electrophoresis tank. DNA was loaded about 3 μl along with 2 μl of 6X loading dye (Cat# DNAA999LB1, Lot # 7M97144, BioShop Canada) using the micropipette in the wells of the gel. In one well DNA ladder ( Cat#DNA009,Lot#7M27175 BioShop Canada) was added. Electrophoresis of the   gel was carried at 120 volts for about 30 minutes. Amount of DNA was visualizes under UVP, Mini Benchtop UV Transilluminator.

4.5.1 Amplification of ticks, by PCR method:

DNA fragment was amplified using universal primers C2-J-3138 and TK-N-3775. Polymerase chain reaction with universal primers placed in nearby region was performed to amplify the fragment of interest.

Table 01: Primer sequence and melting temperature (Tm)

Acc No. Primers sequence Tm
AT1G28300 5’ CAAAGTCTTCACTTCCCTGCAA 3’             Forward

 

62 ̊C
AT1G21970 5’GTTTCTGACCTGGCTATTTCCAGG3’           Reverse 65.3 ̊C

 

4.5.2 Preparation of master mix for PCR:

To amplify the mitochondrial DNA following method used and chemicals added in PCR tubes in following sequence.

Table 02: Product and Quantity for PCR preparation

Product Quantity
Water 5.8 μl
Reverse primer 1μl
Forward primer 1μl
Taq polymerase 0.3μl
DNA sample 2μl
Master mix 10

 

4.5.2 Polymerase chain reaction conditions

Initially the DNA was denatured by heating 94 ̊ C, separated double stranded DNA (dsDNA) to single stranded DNA. Temperature at which 50 percent of the dsDNA was denatured is known as the melting temperature Tm), was determined by the G+C content, the length of the sample and concentration of ions (mainly Mg2+). In the annealing step, the sample was frozen 48̊ C; allow the primers to bind   with  target DNA. In last step   PCR occur at 72̊ C well- known as extension. In this stage, the DNA polymerase extends the DNA from the primers, creat new dsDNA one old strand and one new strand.

Table 03: Polymerase Chain Reaction condition

Cycle Temperature (̊C) Time (min/sec) Phase
 

 

32

 

 

 

 

94 ̊ C 8 min Denaturation
92 ̊ C 1 min Denaturation
48̊ C 1min Annealing
72̊ C 1 min Extention

 

Each reaction carried out in 50 μl volume contain 0.5 μl of oligonucleotides primer, 2.5 mM of dNTP, 5 μl of 10× PCR buffer, 1 μl of Taq DNA polymerase (TaKaRa biomedical group, Shiga, Japan) and 5 μl of the DNA extract and was made up to 50 μl with sterile water.

 

Figure 02: Temperature stages for PCR programming

Figure 02: Temperature stages for PCR programming

4.5.3 Gel Electrophoresis

Amplified fragments were observed through 1.2% agarose gel electrophoresis contain Ethidium bromide under the UVP, Mini Benchtop UV Transilluminator.

4.6 Tick Prevalance at Attawa

At site I, the prevalence of ticks on different body parts of buffaloes was found on the head (27.14%), tail (41.66%), udder (25.71%), and ear (25.71 %) (14.28%) were seen in Table 4.

Table 04: Number of ticks on different body parts of buffaloes from site I of district Gujranwala

 

Number of examined animal

 

Number of infested animal

 

Animal body region

 

Number of ticks from site I

 

Mean±SEM

 

S.D

 

Prevalance %

 

 

 

 

43

 

 

 

 

24

Head 19 6.33±0.577 1.00 27.14%
Tail 23 7.66±0.577 0.577 32.85%
Udder 18 5.66±0.577 0.577 25.71%
Ear 10 3.333±0.577 1.000 14.28%
 

 

Total 70

 

4.7 Tick Prevalance at Moosapur

At site II, the prevalence of tick attachment to infected animals were found in the head (16.66%), tail (42.85%), udder (28.57%) and ear (11.90%) was presented in Table 5.

Table 05: Number of tick on different body parts of buffaloesfrom site II of district Gujranwala

 

Number of examined animal

 

Number of infested animal

 

Animal body region

 

Number of ticks from site II

 

 

Mean±SEM

 

 

S.D

 

 

Prevalance %

 

 

 

 

39

 

 

 

 

16

Head 7 2.666±0.57 0.577 16.66%
Tail 18 6±1.00 1.000 42.85%
Udder 12 4±1.00 0.577 28.57%
Ear 5 1.666±0.577 0.577 11.90%
 

 

Total 42

 

 4.8 Tick Prevalance at Eminabad

In site III, the tick prevalence   to infected animals were found in the head  (20.83%), tail (37.5%), udder (33.33%) and   ear (8.33%)Table 6.

Table 06: Number of ticks on different body parts of buffaloes from site III district Gujranwala

 

Number of examined animal

 

Number of infested animal

 

Animal body region

 

Number of ticks from site II

 

 

Mean±SEM

 

 

S.D

 

 

Prevalance %

 

 

 

 

46

 

 

 

 

18

Head 5 1.666±0.577 0 20.83%
Tail 9 2.666±0.577 0.577 37.5%
Udder 8 2.666±0.577 0.577 33.33%
Ear 2 0.666±0.577 0 8.33%
 

 

Total 24

 P = No. of infested cases during defined period/ population at risk during that    particular time period ×100

Figure 03: Prevalance of ticks infestation in different body parts of buffaloes in district Gujranwala

Figure 03: Prevalance of ticks infestation in different body parts of buffaloes in district Gujranwala

 

4.9 Morphological identification of three tick species

Figure 04: Idetification key of tick species Hyalomma, Rhipicephalous and Boophilus (Walker et al., 2003)

Figure 04: Idetification key of tick species Hyalomma, Rhipicephalous and Boophilus (Walker et al., 2003)

4.10 Identification of bacteria from the salivary gland and midgut of ticks on endo agar

The rate of bacterial isolation were increased in April and declined in January, and rise in the months of November, March, and April. The bacteria in the salivary gland   of ticks was grown on endo agar the   isolation rate of E.coli (20.25%) and Enterococcus (22.78%) was higher from other bacteria Table 7.

Figure 7a: White colonyshowing the growth of E.coli from salivary gland of ticks on endo agar

Figure 7a: White colonyshowing the growth of E.coli from salivary gland of ticks on endo agar

Figure 7b: Creamy white colony showing the growth of Enterococcus spp. and Staphylococcus from salivary gland of ticks on endo agar

Figure 7b: Creamy white colony showing the growth of Enterococcus spp. and Staphylococcus from salivary gland of ticks on endo agar

Figure 7c: White and pink colony showing the growth of Salmonella and Ebterobacter spp. from midgut on endo agar

Figure 7c: White and pink colony showing the growth of Salmonella and Ebterobacter spp. from midgut on endo agar

Figure 7d: White colony showing the growth of Bacillus from midgut on endo agar

Figure 7d: White colony showing the growth of Bacillus from midgut on endo agar

Table 07: Percentage of bacterial isolates from salivary gland and midgut of tick on endo agar

Sr. No.  

Bacterial spp.

 

Colony shape

 

Gram type

 

No. of isolated

Frequency (n) %
1. Staphylococcus Pink, creamy white (Cocci, rod) +ve 15 18.98%
2. Enterobacter spp. Creamy white (Rod) -ve 10 12.65%
3. E.coli White (Rod) -ve 16 20.25%
4. Enterococcus Creamy white, pale pink (Cocci) +ve 18 22.78%
5. Bacillus spp. Creamy white,yellow (Rod) +ve 9 11.39%
6. Salmonella yellow (Rod) -ve 11 13.92%
Total 79  

 

4.11 Identification of bacteria from salivary gland of ticks onsheep blood agar

The bacteria in the salivary gland   of ticks was grown on sheep blood agar the   isolation rate of E.coli (27.77%) and Enterobacter (20.83%) was higher from other than bacteria (Table 8).

Figure 8a: Creamy white colony showing the growth of Enterobacter and E.coli from salivary gland on sheep blood agar

Figure 8a: Creamy white colony showing the growth of Enterobacter and E.coli from salivary gland on sheep blood agar

Figure 8b: Creamy white colony showing the growth of Staphylococcus from salivary gland on sheep blood agar

Figure 8b: Creamy white colony showing the growth of Staphylococcus from salivary gland on sheep blood agar

Figure 8c: Creamy   White and yellowish colony showing the growth of  Salmonella from midgut on sheep blood agar

Figure 8c: Creamy   White and yellowish colony showing the growth of  Salmonella from midgut on sheep blood agar

Figure 8d: White colony showing the growth of E.coli from midgut on sheep blood agar

Figure 8d: White colony showing the growth of E.coli from midgut on sheep blood agar

Table 08: Percentage of bacterial growth from the salivary gland and midgut of tick on sheep blood agar

 

Sr. No.

 

Bacterial spp.

 

Colony shape

 

Gram type

 

No. of isolated

 

Frequency

(n) %

1. Staphylococcus Creamy white (Cocci, rod) +ve 10 13.88%
2. Enterobacter spp. Creamy white (Rod) -ve 15 20.83%
3. E.coli White (Rod,cocci) -ve 20 27.77%
4. Enterococcus Yellow (Cocci) +ve 11 15.27%
5. Bacillus spp. Creamy white (Rod) +ve 7 9.72%
6. Salmonella Yellow,White (Rod) -ve 9 12.5%
Total 72  

 Table 09: Identification of bacteria from the salivary gland of ticks

 

 

Bacterial spp.

 

 

No. of isolated

 

 

Mean±SEM

 

 

S.D

 

Isolation rate from Salivary gland (%)

Enterobacter spp. 25 9±1 1 33.85%
E.coli 36 9±1 1.00 49.07%
Enterococcus 29 12±1.00 1.5 48.52%
Bacillus spp. 16 10±1.00 1.2 37.64%
Salmonella 20 4.66±1.527 0.577 44.26%
Staphylococcus 25 9±1.00 1.5 13.88%

Table 10: Identification of bacteria from the midgut of ticks

Bacterial spp. No. of isolated Mean±SEM S.D Isolation rate from midgut (%)
Enterobacter spp. 15 3.33±0.577 1 33.48%
E.coli 38 7.33±0.577 1.00 48.02%
Enterococcus 36 13.33±1.52 1.5 38.05%
Bacillus spp. 28 11±1.00 1.2 21.11%
Salmonella 31 6±1.00 0.577 26.42%
Staphylococcus 10 3.33±0.577 1.5 18.98%

Figure 09:  Prevalance of bacteria from the midgut and salivary gland of ticks.

Figure 09:  Prevalance of bacteria from the midgut and salivary gland of ticks.

4.12 DNA extracted from three tick species by manual method

The 1kb Ladder was used to visualize a tick DNA fragment of 2000bp. Genomic DNA was placed into wells 1-6, and a 1kb ladder was loaded into wells 7.

Figure 10: Representative photograph of genomic DNA extracted from ticks.

Figure 10: Representative photograph of genomic DNA extracted from ticks.

Note:

DNA ladder = 1 well; DNA fragments = 2-7 wells

Figure 11: Representative photograph of PCR product of ticks

Figure 11: Representative photograph of PCR product of ticks

Note: DNA ladder =1 well; DNA fragment = 2-5

Table 11: DNA extracted of   positive and negative sample from three tick species

 

Name of tick species

 

Number of Ticks

 

Positive sample

 

Negative sample

 

Mean±SEM

 

S.D

 

Percentage positive sample%

Hyalomma anatolicum 35 20 15 12.66±0.5 0.5 54.14.%
Rhipicephalous annulatus 40 23 17 13.33±0.57 0.5 57.5%
Boophilus microplus 50 30 20 13.66±1.15 1.00 60%

Figure 12 Percentage of DNA positive samples of different tick species

Figure 12 Percentage of DNA positive samples of different tick species

  1. DISCUSSION

Tick infestation is a global concern that is also present in Pakistan. Except in the winter, the warm and moist temperatures were ideal for a wide range of parasites particularly ticks. According to a recent study conducted in three villages in Punjab, the prevalenc of Bacillus thuringiesis israelensis reaches 50%. The population rate in our study was lower than the previous reports. A number of factors influence the occurrence of BTI, including agriculture situation, livestock farming techniques, animal inhabitants, and species concerned agent, field handling, demographic status, and improved control technologies are applied. For the development host, and the ticks was dependent on the time period (Salih et al., 2008; Durrani and Shakoori, 2009) in Iran and jammu region. According to earlier surveys in the state, the maximum prevelance of ticks identified in June to August and the minimum was found in April. Tick infestation was also higher in the summer than in the winter, according to a report from another country. The reduced prevalence rate was seen in our study. Buffalo have lower host susceptibility than cattle and ruminants, which could be related to their thicker skin (Varun et al., 2013; Iqbal et al., 2014; Sultana et al., 2015) in Jammu, Punjab and Azad Kashmir. In current study, ticks were identified on many body parts of buffaloes from three sites, including the ear (, neck, tail, and udder, as well as in softer tissue of the remains. The prevalence rate were higher into tail (42.85%), and udder (28.57%) from site I, head (27.14%) and tail (32.85%) from site II and tail (37.5%) and udder (33.33%) from site III. The buffalo lives in a swampy environment, and most of the ticks died as a result of their wallowing (Nady et al.,2014; Sajid et al.,2008a) in Southern Sudan.  In the research region, tick species H. anatolicum, H. anatolicum excavatum, Hyalomma Ixodes excavatum, and I. ricinus were discovered. Rhipicephalus, Boophilus.In present study, identified three tick species (Hyalommaanatolicum, Rhipicephalous and Boophilus Haemaphysalis, Haemaphysalis, and Haemaphysalis were previously identified tick species from another section of the United States. These locations encourage tick mouth parts penetration provide easier contact to the circulation for eating. Tick infestation may be established a major concern among the buffalo population in the Pakistani district of Kheirpur (Kabir et al., 2011; Sajid et al., 2008b) in Durban, South Africa and Banghladesh. The currently, identification of bacteria from the midgut of tick were Enterobacter spp. (33.48%), E.coli (48.02%), Enterococcus (38.05%) , Bacillus spp. (21.11%), Salmonella (26.42%) and   staphylococci (18.98%). The identification of bacteria from the salivary gland   of tick was Enterobacter spp. (19.85%), E.coli (49.07%), Enterococcus (48.52%), Bacillus spp. (37.64%), Salmonella (44.26%) and   staphylococci (13.88%). A different bacterium was recognized Escherichia coli (28.36%), Pseudomonas aeruginosa (18.01%), Bacillus cereus (14.69%), Staphylococcus aureus (13.66%), Citrobacter freundii (13.04%), and Enterobacter species (12.21%). In previous study, six bacteria identified from the midgut and salivary gland (Ibrahem and Zenad, 2015) in Iraq. There was a non-significant higher percentage of tick isolation from the midgut (52.8%) than from the salivary glands (47.2%). The total number of bacterial organisms isolated was substantially higher (P < 0.05). This indicated that ticks are a more severe reservoir for pathogen (Duron et al., 2015; Kang et al., 2014) in China. It’s also been discovered that some tick species carry infections while others don’t. The E. coli bacteria were found in abundance (49.07 percent) in tick species, which was consistent with prior studies. Such a high number of E. coli isolates could be attributable to the organism’s widespread distribution in nature, as well as widespread faecal contamination among buffalo ranches, which could help to increase tick infection or harbouring such pathogens (Pferffer and Dobler, 2011; Andreotti et al., 2011) in Germany and Urban. DNA was extracted by manual method and identified the DNA fragment of approximately 2000bp from ticks with 100% efficiency. Surprisingly, there was no variation in DNA extraction efficiency when the ticks were in different stages of engorgement.A positive control for the success of DNA extraction is the magnification a segment of the tick mitochondrial 16S rRNA gene (Parola and Raoult, 2001) in Switzerland. PCR was a critical step for the detection and investigations of pathogen DNA. It ensured that the DNA being amplified is of good quality and no inhibiting factors were present. Previous research has found considerable variability in tick infection rates, emphasising the need for such a positive control. Extraction controls were not always used in investigations of Babesia sp. disease ratio in tick, for example, and ranged from 6.2 percent to 62 percent infection in questing or engorged ticks (Foppa et al., 2002) in France.

  1. CONCLUSION

Buffalo ticks had the largest population, tick infestation frequency varied depending on farm, and packed residents, animal presentation determined by milk output, and animal growth dropped gradually. Throughout, inspection by several locations, it was discovered that the general mean number of ticks differed dramatically from one location to the next. Identify novel tick species on buffalo, including H. anatolicum, Rhipicephalous Boophilus, and I. ricinus, during the experiment. The farm discovered in good hygienic conditions have a lower infestation rate than farms in poor hygienic conditions. Tick-borne pathogens that harm humans and animals were explored in this study. Different types of hard ticks transmit these infections. Ticks and tick-borne diseases are a major public health concern all over the world. The high rate of aerobic pathogen isolation from ticks may represent the arthropod’s active role in environmental pollution, which increases the risk of bacterial pathogen transmission to their hosts.

REFERENCES

  • Abbasi, F., Abbasi, I.H.R., Nissa, T.F., Bhutto, Z.A., Arain, M.A., Soomro, R.N., Siyal, F.A. and  Fazlani, S.A. 2017. Epidemiological study of tick infestation in buffalo of various regions of district Khairpur, Pakistan. Veterinary World, 10(6): 688-694.
  • Ahmad, Z., Anwar, Z.,   Adnan, M., Imtiaz, N., Rashid, H.U.  and Gohar, F. 2019. Collection and prevalence of ticks in cattles and buffaloes from free-range management systems of Islamabad. The Journal of Basic and Applied Zoology, 80(1): 1-4.
  • Andreotti, R., Perez, A.A., Dowd, S.E., Guerrero, F.D., Bendele, K.G. and Scoles, G.A. 2011. Assessment of bacterial diversity in the cattle tick Rhipicephalus (Boophilus) microplus through tagencoded pyrosequencing. BMC Microbiol, 113(10): 3697-3701.
  • Bianca, B. E. 2008. Xylanase production by Aspergillus niger LPB 326 in solid-state fermentation using statistical experimental designs. Food Technology and Biotechnology, 46(2):  183-189.
  • Chen, Y., Evans, J. and Feldlaufer, M. 2006. Horizontal and vertical transmission of viruses in the honeybee, Apis mellifera. Journal ofIinvertebrate Pathology, 92(3): 152-159.
  • Coetzee, G. A. Mulholland, D. J., Dedhar, S. and Nelson, C. C. 2005. Interaction of nuclear receptors with the Wnt/β-catenin/Tcf signaling axis. Endocrine Reviews, 26(7): 898-915.
  • Crowder, D. W., Horowitz, A. R., De Barro, P. J., Liu, S. S., Showalter, A. M., Kontsedalov, S. and Carrière, Y. 2010. Mating behaviour, life history and adaptation to insecticides determine species exclusion between whiteflies. Journal of Animal Ecology, 79(3): 563-570.
  • Dennis, D. T. and Piesman, J. F. 2005. Overview of tick borne infections of humans. Tick‐borne Diseases of Humans, 41(3): 1-11.
  •  Dhital, B., Shrestha, S., Kaphle, K. and Pudasaini, R. 2018.Study on distribution of cattle tick from mid hills to plain of nipal.Journal of Veterinary Science & Technology, 9(6): 567
  • Dumler, J.S. and Rosen, F. A. 2000.  Microbiology and Laboratory Diagnosis of Tick-Borne Diseases. Cunhu BA. (Ed).Tick Borne Infectious Diseases, Diagnosis and Management. New York, USA, 19(24): 15-50.
  • Duron, O.  2015. The recent evolution of a maternally inherited endosymbiont of ticks led to the emergence of the Q fever pathogen, Coxiella burnetii. PLoS Pathog, 11(5): 831-838.
  • Edwards, J. R., Peterson, K. D., Andrus, M. L., Tolson, J. S., Goulding, J. S., Dudeck, M. A. and Facilities, N. H. S. N. 2007. National Healthcare Safety Network (NHSN) report, data summary for 2006, issued June 2007. American Journal of Infection Control, 35(5): 290-301.
  • Foppa, I.M., Krause, P.J., Spielman, A., Goethert, H., Gern, L., Brand, B. and Telford, S.R 2002. 3rd, Entomologic and serologic evidence of zoonotic transmission of Babesia microti, eastern Switzerland, Emerg. Infectious Diseases, 8(7):  722–726.
  •  Fuente, J., Pena, E. A., Venzal, J. M., Kocan, K. M. and Sonenshine, D. E. 2008. Overview: ticks as vectors of pathogens that cause disease in humans and animals. Front Bioscience, 13(13):  6938-6946.
  • Gray, J. R., Lazar, S. W., Kerr, C. E., Wasserman, R. H., Greve, D. N., Treadway, M. T. and  Fischl, B. 2005. Meditation experience is associated with increased cortical thickness. Neuroreport, 16(17):  1893.
  • Halverson, G. P., Wade, B. P., Hurtgen, M. T. and  Barovich, K. M. 2010. Neoproterozoic chemostratigraphy. Precambrian Research, 182(4): 337-350.
  • Hassan, R. H. and    Zubaidi, H. H. 2014. Cattle and buffaloes tick’s infestation in Wasit province districts, Iraq. Kufa. Journal. Veterinary. Medical. Science, 5(1):  31-40.
  • Iqbal, J., Abbasi, B. A., Mahmood, T., Kanwal, S., Ali, B., Shah, S. A. Khalil, A. T.  2017. Plant-derived anticancer agents: A green anticancer approach. Asian Pacific Journal of Tropical Biomedicine, 7(12): 1129-1150.
  • Irshad, M. Anwar, Z. and   Gulfraz, M.  2014. Agro-industrial lignocellulosic biomass a key to unlock the future bioenergy: a brief review. Journal of radiation research and applied sciences, 7(2):  163-173.
  • Jabbar, A., Abbas, T., Saddiqi, H. A., Qamar, M. F. and  Gasser, R. B. 2015. Tick-borne diseases of bovines in Pakistan: major scope for future research and improved control. Parasites &Vectors, 8(1):  1-13.
  • Jalil, W. I. and  Zenad, M. M. 2016. Isolation of aerobic bacteria from ticks infested sheep in Iraq. Asian Pacific Journal of Tropical Biomedicine, 6(1):  67-70.
  • Jongejan, F. and  Uilenberg, G. 2004. The global importance of ticks. Parasitology-Cambridge, 4 (9): 1471-1472.
  • Kabir, S., Shahriar, M., Haque, M. R., Dewan, I. and Bhuyian, M. A. 2011. Effect of proteinase-K on genomic DNA extraction from Gram-positive strains. Stamford Journal of Pharmaceutical Sciences, 4(1): 53-57.
  • Kang, Y.J., Diao, X.N., Zhao, G.Y., Chen, M.H., Xiong, Y. and Shi, M. 2014.Extensive diversity of Rickettsiales bacteria in two species of ticksfrom China and the evolution of the Rickettsiales. BMC Evol Boil, 14: 167.
  • Kaur, G., Pandey, O. P., Singh, K., Homa, D., Scott, B. and  Pickrell, G. 2014. A review of bioactive glasses: their structure, properties, fabrication and apatite formation. Journal of Biomedical Materials Research, 102(1):  254-274.
  • Kazimirova, M. and Stibraniova, I. 2013. Tick salivary compounds: their role in modulation of host defences and pathogen transmission. Front Cell Infect Microbiol,3: 43.
  • Khalaf, D., Annala, M., Vandekerkhove, G., Taavitsainen, S., Beja, K., Warner, E. W. and  Chi, K. N. 2018. Circulating tumor DNA genomics correlate with resistance to abiraterone and enzalutamide in prostate cancer. Cancer Discovery, 8(4):  444-457.
  • Khalil, H. A., Yap, S. W., Tye, Y. Y., Tahir, P. M., Rizal, S. and  Fazita, M. N. 2018. prevalence of ticks infesting buffaloes in and around jampur district ranjanpur, Pakistan. Fauuast journal.biology., 8(2): 327-330
  • Kolte, D., Khera, S., Sardar, M. R., Gheewala, N., Gupta, T., Chatterjee, S.and   Abbott, J. D. 2017. Thirty-day readmissions after transcatheter aortic valve replacement in the United States: insights from the Nationwide Readmissions Database. Circulation: Cardiovascular Interventions, 389(10082): 1885-1906.
  • Korenberg, E. I., Vorobyeva, N. N.and  Grigoryan, Y. V. 2007. Diagnostics of tick-borne diseases in the endemic region of Russia. Wiener Klinische Wochenschrift, 114(13/14): 610-612.
  • Lalzar, O. M., Sela, N., Voronov, G. M., Green, S. J., Hadar, Y. and Minz, D. 2014. Niche and host-associated functional signatures of the root surface microbiome. Nature Communications, 5(1):   1-9.
  •  Lejal, E., Moutailler, S., Simo, L., Vayssier-Taussat, M. and Pollet, T. 2019. Tick-borne pathogen detection in midgut and salivary glands of adult Ixodes ricinus. Parasites &Vectors, 12(1): 152.
  • Mahagna, M., Yosef, B. M., Rot, A., Kapri, E., Behar, A. and   Gottlieb, Y. 2020. Coxiella-like endosymbiont of Rhipicephalus sanguineus is required for physiological processes during ontogeny. Frontiers in Microbiology, 11: 493.
  • Maqbool, Z., Hussain, S., Imran, M., Mahmood, F., Shahzad, T., Ahmed, Z. and  Muzammil, S. 2016. Perspectives of using fungi as bioresource for bioremediation of pesticides in the environment: a critical review. Environmental Science and Pollution Research, 23(17): 16904-16925.
  • Orkun, O., Karaer, Z., Çakmak, A. and  Nalbantoglu, S. 2014. Spotted fever group rickettsiae in ticks in Turkey. Ticks and tick-borne diseases, 5(2): 213-218.
  • Parola, P. and Raoult D. 2001. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin. Infect. Dis, 32(6): 897-928.
  • Pferffer, M. and   Dobler, G.2011. Tick-borne encephalitis virus in dogs-is this an issue.Parasite Vectors, 4(1): 59.
  • Rafique, H., Almagrabi, A. O., Shamim, A., Anwar, F. and  Bashir, A. K. 2020. Investigating the acceptance of mobile library applications with an extended technology acceptance model (TAM). Computers & Education, 145: 103732.
  • Ramezani, Z., Alinejad, S.P., Edalat, H., Telmadarraiy, Z., Dabiri, F., Vatandoost, H. and  Chavshin, A. R. 2020. Molecular characterization of Ribosomal DNA (ITS2) of hard ticks in Iran: understanding the conspecificity of Dermacentor marginatus and D. niveus. BMC Research Notes, 13(1): 1-6.
  • Reis, C., Cote, M., Paul, R.E.L. and  Bonnet S. 2012. Questing ticks in suburban forest are infected by at least six tick-borne pathogens. Vector Borne Zoonotic Dis, 11: 907–16.
  • Romero, J. R. and   Simonsen, K. A. 2008. Powassan encephalitis and Colorado tick fever. Infectious disease clinics of North America, 22(3): 545-559.
  • Sajid, M. S., Iqbal, Z., Khan, M. N., Muhammad, G. and  Khan, M. K. 2009. Prevalence and associated risk factors for bovine tick infestation in two districts of lower Punjab, Pakistan. Preventive Veterinary Medicine, 92(4): 386-391.
  • Salih, D.A., Julia, I.I., Hassan, S.M., El-Hussain, A.M. and Jongejan, F. 2008. Preliminary survey of ticks (Acari: Ixodidae) on cattle in central Equatoria state, Southern Sudan. Onderstepoort J. Vet. Res., 75(4): 47-53.
  • Shen, X., Tang, H., McDanal, C., Wagh, K., Fischer, W., Theiler, J.and Montefiori, D. C. 2021. SARS-CoV-2 variant B. 1.1. 7 is susceptible to neutralizing antibodies elicited by ancestral spike vaccines. Cell Host &Microbe, 29(4): 529-539.
  • Sima, C. S., Helena, A. Y., Arcila, M. E., Rekhtman, N., Zakowski, M. F., Pao, W. and  Riely, G. J. 2013. Analysis of tumor specimens at the time of acquired resistance to EGFR-TKI therapy in 155 patients with EGFR-mutant lung cancers. Clinical CancerRresearch, 19(8):  2240-2247.
  • Sultana, J., Siddique, M. N. A. and Abdullah, M. R. 2015. Fertilizer recommendation for agriculture: practice, practicalities and adaptation in Bangladesh and Netherlands. International Journal of Business, Management and Social Research, 1(1): 21-40.
  • Sutton, A. J., Peters, J. L., Jones, D. R., Abrams, K. R. and  Rushton, L. 2006. Comparison of two methods to detect publication bias in meta-analysis. Jama, 295(6):  676-680.
  • Tucker, C. 2008. Identifying formal and informal influence in technology adoption with network externalities. Management Science, 54(12): 2024-2038.
  • Uguz, M. T., Salih, W. M., Kirecci, E. and  Mohammed, B. A. 2015. Isolation and identification of tick-  borne bacterial pathogens in Turkey and Iraq. African Journal of Microbiology Research, 9(24): 1608-1612.
  • Walker, A.R., Bouattour, A., Camicas, J.L., Estrada, P.A., Horak, I.G., Latif, A., Pegram, R.G.and Preston, P.M. 2003. Ticks of domestic animals in Africa: a guide to identification of species. Bioscience Reports, U.K.  pp. 221.
  • Wiley, B. J., Martinez, A. W., Phillips, S. T., Gupta, M. and  Whitesides, G. M. 2008. FLASH: a rapid method for prototyping paper-based microfluidic devices. Lab on a Chip, 8(12): 2146-2150.
  • Yu, W., Zou, W., Dhital, S., Wu, P., Gidley, M. J., Fox, G. P. and   Gilbert, R. G. 2018. The adsorption of α-amylase on barley proteins affects the in vitro digestion of starch in barley flour. Food chemistry, 241: 493-501.

Publication History

Submitted: October 08, 2023
Accepted:   October 11, 2023
Published: December 11, 2023

Identification

D-0171

Citation

Saffora Riaz, Kinza Imtiaz, Lubna Rasheed, Aqsa Mubeen, Tasneem Kausar & Rooha Farooq (2023). Identification of the Bacterial Pathogen of Ticks and Ticks Infestation in Buffaloes in District Gujranwala. Dinkum Journal of Natural & Scientific Innovations, 2(12):794-814.

Copyright

© 2023 DJNSI. All rights reserved